Sequence ID | >SRA1014125 |
Genome ID | SRR023845.9373 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 61 |
End posion on genome | 133 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atctttacaa |
tRNA gene sequence |
CGCGAGATGGAAAAGTGGTAATTCGCTGGGCTCATAACCCAGAGATCAGCAGTTCGAATC |
Downstream region at tRNA end position |
atattggcgt |
Secondary structure (Cloverleaf model) | >SRA1014125 Met CAT a ACac atattggcgt C A G - C C - G G - C A - T G - C A - T T A T T C G T C A G A G | | | | | G T A A A G A G C A G C G | | | T T G A T T C T A G AGATC C - G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |