Sequence ID | >SRA1014142 |
Genome ID | SRR023845.16717 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 156 |
End posion on genome | 86 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tggtttagta |
tRNA gene sequence |
AGGAGTTTAGTTGAGTGGTTTAACGCCGTCTTTACACGACGGATACAGGGGTTCAATTCC |
Downstream region at tRNA end position |
ttcatgacca |
Secondary structure (Cloverleaf model) | >SRA1014142 Val TAC a Ataa ttcatgacca A - T G + T G - C A - T G - C T - A T - A T T T T C T C C A G A A | | + | | A T G T T G A G G G G C G + | | | T T G T A A C T T G ATAC C - G C - G G - C T - A C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |