Sequence ID | >SRA1014165 |
Genome ID | SRR023845.22967 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 122 |
End posion on genome | 38 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcacctgcac |
tRNA gene sequence |
GCGCGAGTGGCGGAATTGGCAGACGCGCCAGGTTTAGGTCCTGGTGTCTCAGGACGTGGG |
Downstream region at tRNA end position |
gcaggtgagt |
Secondary structure (Cloverleaf model) | >SRA1014165 Leu TAG c ACCA gcaggtgagt G - C C - G G - C C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGTCTCAGGACGT C - G C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |