Sequence ID | >SRA1014166 |
Genome ID | SRR023845.23678 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 111 |
End posion on genome | 37 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ccggcaccgc |
tRNA gene sequence |
GCTGCGGTAGCTCAGTGGTAGAGCACCTCATTGGTAATGAGGAGGTCGAGAGTTCAATCC |
Downstream region at tRNA end position |
tttaccccct |
Secondary structure (Cloverleaf model) | >SRA1014166 Thr GGT c ACCA tttaccccct G - C C - G T - A G - C C - G G - C G + T C T T C T C T C A G A A | | | | | A T C T C G G A G A G C G | | | | T T G G A G C T A A AGGTC C - G C - G T - A C - G A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |