Sequence ID | >SRA1014179 |
Genome ID | SRR023845.29693 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 148 |
End posion on genome | 220 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ggtgcaggga |
tRNA gene sequence |
TTCTCGTTAGTATAGTGGTTAGTATACCCGCCTGTCACGCGGGTGACCCGGGTTCAATTC |
Downstream region at tRNA end position |
ttgctctttt |
Secondary structure (Cloverleaf model) | >SRA1014179 Asp GTC a GCtt ttgctctttt T - A T - A C - G T + G C - G G - C T - A T T T G G C C C A T G A A | | | | | A G T A T G C C G G G C G + | | + T T T G T A T T A A TGAC C - G C - G C - G G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |