Sequence ID | >SRA1014184 |
Genome ID | SRR023845.31703 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 134 |
End posion on genome | 60 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttttttctgt |
tRNA gene sequence |
GGGGCTGTAGTTCAGGGGTAGAACGCTTCCGTGACAAGGAAGAGGTCGTTTGTTCGAATC |
Downstream region at tRNA end position |
ccgaaatttt |
Secondary structure (Cloverleaf model) | >SRA1014184 Val GAC t ACCA ccgaaatttt G - C G + T G - C G - C C - G T - A G - C T A T C A A A C A G A A | | | | | G G C T T G G T T T G C G | | | | T T G G A A C T A G AGGTC C - G T - A T - A C - G C - G G A T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |