Sequence ID | >SRA1014187 |
Genome ID | SRR023845.32559 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 39 |
End posion on genome | 111 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cttcgtgtcg |
tRNA gene sequence |
GCTGTGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGTCCCGTGTTCGATC |
Downstream region at tRNA end position |
ttttgaatcg |
Secondary structure (Cloverleaf model) | >SRA1014187 Phe GAA g Atct ttttgaatcg G - C C - G T + G G - C T - A G - C A - T C T T G G C A C A T G A A | | | | | G T C T C G C C G T G C G | | | | T T G G A G C G A G AGGTC T - A C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |