Sequence ID | >SRA1014199 |
Genome ID | SRR023845.36176 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 49 |
End posion on genome | 135 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gcgtgggttg |
tRNA gene sequence |
GCCAGTGTCGGATAGCGGTCGATTCCGCCTGATTTGTAATCAGGATGCGCAAGCGCGTCG |
Downstream region at tRNA end position |
gtaaaaatgc |
Secondary structure (Cloverleaf model) | >SRA1014199 Thr TGT g TCTA gtaaaaatgc G - C C - G C - G A - T G - C T - A G - C T A T C T C C C A C G A C | + | | | G G T A G G G G G G G C G | | | T T T T T C C C G A G ATGCGCAAGCGCGTC C - G C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |