Sequence ID | >SRA1014209 |
Genome ID | SRR023845.40285 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 14 |
End posion on genome | 103 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
aggcccccgc |
tRNA gene sequence |
GGAGAGGTGGCAGAGCGGTTGAATGCACCGCACTCGAAATGCGGCATGCCTGCAAGGGCA |
Downstream region at tRNA end position |
gttatcttgc |
Secondary structure (Cloverleaf model) | >SRA1014209 Ser CGA c GCCA gttatcttgc G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A C G A G | | | | | G G G A C G G G G G G C G | | | T T T A T G C T G A A CATGCCTGCAAGGGCATC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |