Sequence ID | >SRA1014212 |
Genome ID | SRR023845.40978 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 248 |
End posion on genome | 165 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ggtcaccgct |
tRNA gene sequence |
GCCCCTGTGGCGAAATGGTAGACGCGACCGACTCAAAATCGGTTGCCGCGAGGCGTGCTG |
Downstream region at tRNA end position |
aggatcaatc |
Secondary structure (Cloverleaf model) | >SRA1014212 Leu CAA t ACCA aggatcaatc G - C C - G C - G C - G C - G T - A G - C T G T C G G C C A T A A G | | + | | A G A G C G G C T G G C G | | | T T T A C G C A G G TGCCGCGAGGCGT A - T C - G C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |