Sequence ID | >SRA1014225 |
Genome ID | SRR023845.45359 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 8 |
End posion on genome | 92 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
nnntaaaacc |
tRNA gene sequence |
GCGGTCGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCG |
Downstream region at tRNA end position |
aatctcatcg |
Secondary structure (Cloverleaf model) | >SRA1014225 Leu GAG c ACCA aatctcatcg G - C C - G G - C G - C T - A C - G G - C T G T C G C T C A T A A G | | | | | G T A G T G G C G A G C G | | | T T G A C A C T A G G TGGCGAAAGCTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |