Sequence ID | >SRA1014230 |
Genome ID | SRR023845.46830 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 50 |
End posion on genome | 125 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gctggcgcat |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGGTTGCTTTGCAAGCATCAGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
attcgagcgc |
Secondary structure (Cloverleaf model) | >SRA1014230 Ala TGC t ACCA attcgagcgc G - C G - C G + T G - C C - G C - G T - A C T T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A G AGGTC G - C T T T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |