Sequence ID | >SRA1014239 |
Genome ID | SRR023845.50393 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 4 |
End posion on genome | 78 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnnnnnntgt |
tRNA gene sequence |
TCCCTGATAGCTCAGCGGTAGAGCATTCGACTGTTAATCGAATGGCCGTAGGTTCGAATC |
Downstream region at tRNA end position |
gcgaccctcc |
Secondary structure (Cloverleaf model) | >SRA1014239 Asn GTT t GCCA gcgaccctcc T - A C - G C - G C - G T - A G - C A - T T A T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A TGGCC T - A T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |