Sequence ID | >SRA1014256 |
Genome ID | SRR023845.61047 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 126 |
End posion on genome | 51 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
agcccatcac |
tRNA gene sequence |
GCCGGTATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCCGGGTTCGACT |
Downstream region at tRNA end position |
tacgcaacac |
Secondary structure (Cloverleaf model) | >SRA1014256 Thr TGT c ACCA tacgcaacac G - C C - G C - G G - C G - C T + G A - T T C T G G T C C A T G A A | | + | | G T C T C G C C G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |