Sequence ID | >SRA1014276 |
Genome ID | SRR023845.68048 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 131 |
End posion on genome | 46 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tgtgtttttt |
tRNA gene sequence |
GGGGAGTTTCCAGAGTGGCCAAATGGATCAGACTGTAAATCTGCTGGCGTACGCCTTCGG |
Downstream region at tRNA end position |
aaaagttgta |
Secondary structure (Cloverleaf model) | >SRA1014276 Tyr GTA t ACAA aaaagttgta G - C G - C G - C G - C A - T G - C T - A T A T C C T C C A T G A T | | | | | G G G A C C G G A G G C G | | | T T C A T G G C A A A TGGCGTACGCCTTC T C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |