Sequence ID | >SRA1014281 |
Genome ID | SRR023845.69644 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 135 |
End posion on genome | 209 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gacgtccctg |
tRNA gene sequence |
GCCCCCATAGCTCAGGGGATAGAGCACTGCCCTCCGGAGGCAGGGGCGAAGGTTCGAATC |
Downstream region at tRNA end position |
cctcggccga |
Secondary structure (Cloverleaf model) | >SRA1014281 Arg CCG g ACCA cctcggccga G - C C - G C - G C - G C - G C - G A - T T A T C T T C C A G G A A | | | | | G G C T C G G A A G G C G | | | | T T A G A G C T A A GGGC C - G T - A G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |