Sequence ID | >SRA1014319 |
Genome ID | SRR023845.87784 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 203 |
End posion on genome | 129 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ttcccaacat |
tRNA gene sequence |
GGACGATTAGCTCAGTGGTAGAGCAGACGCTTGATAGGCGTCAGGTCCCAGGTTCAAGTC |
Downstream region at tRNA end position |
acctcgcggc |
Secondary structure (Cloverleaf model) | >SRA1014319 Ile GAT t TCCA acctcgcggc G - C G - C A - T C - G G - C A - T T C T G T G G T C C A G A A | | | | | A T C T C G C C A G G C G | | | | T T G G A G C T A A AGGTC G - C A - T C - G G - C C - G T G T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |