Sequence ID | >SRA1014327 |
Genome ID | SRR023845.89792 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 47 |
End posion on genome | 122 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tgttctgtac |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGAGAGTTCGAGC |
Downstream region at tRNA end position |
gttcnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1014327 Gly GCC c TCCA gttcnnnnnn G - C C - G G - C G - C G - C A - T G - C C G T T T C T C A T G A A + | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |