| Sequence ID | >SRA1014332 |
| Genome ID | SRR023845.92752 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 258 |
| End posion on genome | 182 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
ggagacgcgt |
| tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTAGCGCACTTGGATGGGGTCCAAGGGGTCGGAGGTTCGAA |
| Downstream region at tRNA end position |
gtttgaagcc |
| Secondary structure (Cloverleaf model) | >SRA1014332 Pro GGG
t ACCA gtttgaagcc
C - G
G - C
G - C
A - T
G - C
C - G
G - C T A
T T C T C C A
C G A A + | | | | G
C C G C G G G A G G C
T | | | | T T
G G C G C
G T A A GGGTC
C - G
T - A
T - A
G - C
G - C
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |