Sequence ID | >SRA1014360 |
Genome ID | SRR023845.103988 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 129 |
End posion on genome | 205 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tccgcgcagt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCTTGGTAGCGCATTTGTCTGGGGGACAAAGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
ttttcactaa |
Secondary structure (Cloverleaf model) | >SRA1014360 Pro GGG t ACCA ttttcactaa C - G G - C G - C G + T G - C C - G G - C T A T T G T C C A C G A A + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC T - A T - A T - A G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |