Sequence ID | >SRA1014361 |
Genome ID | SRR023845.104093 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 30 |
End posion on genome | 104 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccgggcgcgg |
tRNA gene sequence |
TCCGCCATGGTGTAACGGCAGCACGACAGCCTTTGGAGCTGTTAGGTCCAGGTTCGAATC |
Downstream region at tRNA end position |
atgagtcgac |
Secondary structure (Cloverleaf model) | >SRA1014361 Gln TTG g GCCG atgagtcgac T - A C - G C - G G - C C - G C - G A - T T A T G G T C C A A A G | | | | | G C T G T G C C A G G C G + | | | T T G G C A C C A G TAGGT A - T C - G A - T G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |