Sequence ID | >SRA1014362 |
Genome ID | SRR023845.104501 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 215 |
End posion on genome | 120 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
agattgaccc |
tRNA gene sequence |
GGAAGAGAATCGTCCCCGGTGGGGCGTACGGACTTCAAATCCGTGTGGGGCCGTGAGACG |
Downstream region at tRNA end position |
tcctcccgtc |
Secondary structure (Cloverleaf model) | >SRA1014362 SeC TCA c GCCA tcctcccgtc G - C G - C A - T A C G - C A - T G - C A - T T C A C A C C C A C C C T | | | | | G G C T G C G T G G G C G | + | | T T T G G C G G G T GTGGGGCCGTGAGACGGTCCTTG A - T C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |