Sequence ID | >SRA1014374 |
Genome ID | SRR023845.113302 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 193 |
End posion on genome | 118 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ccaaccgcgc |
tRNA gene sequence |
GGGGCCGTAGCTCAGATGGGAGAGCGCTGCAATCGCACTGCAGAGGTCAAGGGTTCGATT |
Downstream region at tRNA end position |
tgcgtaagat |
Secondary structure (Cloverleaf model) | >SRA1014374 Ala CGC c ACCA tgcgtaagat G - C G - C G + T G - C C - G C - G G - C T T T T T C C C A A G A A | | | | | G T C T C G A A G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A G - C C - G A - T A C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |