Sequence ID | >SRA1014378 |
Genome ID | SRR023845.113966 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 17 |
End posion on genome | 99 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cggtgctgcc |
tRNA gene sequence |
GCGGGAGTGGTGGAATTGGCAGACACGCAGGATTTAGGTTCCTGTGCTTTCGAGCGTGAG |
Downstream region at tRNA end position |
agagcgccgt |
Secondary structure (Cloverleaf model) | >SRA1014378 Leu TAG c ACac agagcgccgt G - C C - G G - C G - C G - C A - T G - C T G T T T C C C A T A A G + | | | | A T G G T G G A G G G C G | | | T T G A C A C C A G G TGCTTTCGAGCGT C - G A - T G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |