Sequence ID | >SRA1014382 |
Genome ID | SRR023845.115017 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 101 |
End posion on genome | 27 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gttccaggat |
tRNA gene sequence |
GCGGGCATCGTATAATGGCTATTACCTCAGCCTTCCAAGCTGATGATGTGGGTTCGATTC |
Downstream region at tRNA end position |
agatgtgctg |
Secondary structure (Cloverleaf model) | >SRA1014382 Gly TCC t TCCA agatgtgctg G - C C - G G - C G - C G - C C - G A - T T T T C A C C C A T A A C | | | | | G G T A T G G T G G G C G | | | T T C T T A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |