Sequence ID | >SRA1014392 |
Genome ID | SRR023845.118302 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 169 |
End posion on genome | 254 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaacccgcaa |
tRNA gene sequence |
GCGGACGTGGCGGAATCGGTATACGCAGCAGACTTAAAATCTGCCGACCTCTGGTCTTGC |
Downstream region at tRNA end position |
gaccttgata |
Secondary structure (Cloverleaf model) | >SRA1014392 Leu TAA a ACCA gaccttgata G - C C - G G - C G - C A - T C - G G - C T G T C G C C C A T A A G | | | | | A C G G C G G C G G G C G | | | T T G A C G C T A T A CGACCTCTGGTCTT G - C C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |