Sequence ID | >SRA1014394 |
Genome ID | SRR023845.118773 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 193 |
End posion on genome | 122 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ggccgctcac |
tRNA gene sequence |
GGGGATGTAGCTCAATGGTAGAGCCTCAGTCTTCCAAACTGATCACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
tgtttgttcg |
Secondary structure (Cloverleaf model) | >SRA1014394 Gly TCC c TCtg tgtttgttcg G - C G - C G - C G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C TCAC T - A C - G A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |