Sequence ID | >SRA1014400 |
Genome ID | SRR023845.120934 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 225 |
End posion on genome | 150 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
accgcctcgt |
tRNA gene sequence |
GCCGCAATAGCTCAGCTGGTAGAGCACCTCATTCGTAATGAGGGGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
cgttcttccc |
Secondary structure (Cloverleaf model) | >SRA1014400 Thr CGT t ACCA cgttcttccc G - C C - G C - G G - C C - G A - T A - T T A T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |