Sequence ID | >SRA1014404 |
Genome ID | SRR023845.122979 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 165 |
End posion on genome | 241 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgatccgcac |
tRNA gene sequence |
AGGGGTGTAGCTCAGTTGGTTAGAGCGTCGGTCTCCAAAACCGAAGGCCCTCGGTTCGAG |
Downstream region at tRNA end position |
gcgctccgct |
Secondary structure (Cloverleaf model) | >SRA1014404 Trp CCA c GCCA gcgctccgct A - T G - C G - C G - C G - C T T G - C T G T G A G C C A T G A A | | | | | G T C T C G C T C G G C G | | | | T T G G A G C T T A G AGGCC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |