Sequence ID | >SRA1014407 |
Genome ID | SRR023845.124798 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 142 |
End posion on genome | 217 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tcgcacccga |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCCAGGACACTGCCCTTTCACGGCTGTAACAGGGGTTCGAAT |
Downstream region at tRNA end position |
caccggtaac |
Secondary structure (Cloverleaf model) | >SRA1014407 Glu TTC a GCCA caccggtaac G - C T - A C - G C - G C - G C - G A - T T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C C A A TAAC C - G T T G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |