Sequence ID | >SRA1014408 |
Genome ID | SRR023845.126375 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 165 |
End posion on genome | 92 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaggggaaga |
tRNA gene sequence |
AGCGGGGTAGAGTAGTTGGTTAACTCGTCAGGCTCATAACCTGAAGATTGCAGGTTCGAA |
Downstream region at tRNA end position |
cttgatttcg |
Secondary structure (Cloverleaf model) | >SRA1014408 Met CAT a Atgt cttgatttcg A C G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A A | | | | | G T T G A G G C A G G C G | | | | T T G A C T C T T A G AGATT T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |