Sequence ID | >SRA1014413 |
Genome ID | SRR023845.127366 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 185 |
End posion on genome | 259 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cggtccgcgc |
tRNA gene sequence |
GGTCCTGTGGCTCAGTGGAAGAGCGTCCCGTTCACACCGGGAAGGTCGCTGGTTCGAACC |
Downstream region at tRNA end position |
caacgcaggc |
Secondary structure (Cloverleaf model) | >SRA1014413 Val CAC c ACCG caacgcaggc G - C G - C T - A C - G C - G T - A G - C C A T C G A C C A G A G | | | | | G T C T C G G C T G G C G | | | | T T G G A G C A A G AGGTC T - A C - G C - G C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |