Sequence ID | >SRA1014417 |
Genome ID | SRR023845.130118 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 127 |
End posion on genome | 203 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acacagagat |
tRNA gene sequence |
GGGCCCGTAGCTCAGTTGGTTAGAGCACACGCTTGATAAGCGTGGGGTCGGTAGTTCAAG |
Downstream region at tRNA end position |
atggttttag |
Secondary structure (Cloverleaf model) | >SRA1014417 Ile GAT t ACCA atggttttag G - C G - C G - C C - G C - G C - G G - C T G T C C A T C A T G A A | | | | | A T C T C G G G T A G C G | | | | T T G G A G C T T A A GGGTC C - G A - T C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |