Sequence ID | >SRA1014424 |
Genome ID | SRR023845.132319 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 115 |
End posion on genome | 205 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cactttctgc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAATGACGCTGCACTCGAAATGCAGTGTACGGGAAACCGT |
Downstream region at tRNA end position |
gcaagtccta |
Secondary structure (Cloverleaf model) | >SRA1014424 Ser CGA c GCCA gcaagtccta G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G T G A G | | | | | G G G A C G G T G G G C T + | T T C T G A C G A A G TGTACGGGAAACCGTACC C - G T - A G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |