Sequence ID | >SRA1014425 |
Genome ID | SRR023845.134073 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 171 |
End posion on genome | 96 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agtggttcac |
tRNA gene sequence |
GGGACGTTAGCTCAGTTGGTAGAGCAGCGGACTTTTAATCCGTTTGTCGTGGGTTCGACC |
Downstream region at tRNA end position |
acaacccgaa |
Secondary structure (Cloverleaf model) | >SRA1014425 Lys TTT c ACCA acaacccgaa G - C G - C G - C A - T C - G G - C T - A C C T C G C C C A T G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TTGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |