Sequence ID | >SRA1014435 |
Genome ID | SRR023845.141565 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 22 |
End posion on genome | 95 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gtttagtgtT |
tRNA gene sequence |
GGGGGAATAGCTCAGTGGTAGAGCGCTGGATTCCAGTCCCAGCGGTCGGGGGTTCGATCC |
Downstream region at tRNA end position |
tttgttctgt |
Secondary structure (Cloverleaf model) | >SRA1014435 Trp CCA T ATtc tttgttctgt G - C G + T G - C G - C G - C A - T A - T C T T C T C C C A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G CGGTC C - G T - A G - C G - C A C T T T G C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |