| Sequence ID | >SRA1014441 |
| Genome ID | SRR023845.144039 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 119 |
| End posion on genome | 194 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
cagcttcaat |
| tRNA gene sequence |
TCCCTGATAGCTCAGTTGGTAGAGCGACGGACTGTTAATCCGCAGGTCCCTGGTTCGAGT |
| Downstream region at tRNA end position |
gaatataaga |
| Secondary structure (Cloverleaf model) | >SRA1014441 Asn GTT
t GCCA gaatataaga
T - A
C - G
C - G
C - G
T + G
G - C
A - T T G
T G G A C C A
T G A A | | | | | G
T C T C G C C T G G C
G | | | | T T
G G A G C
T A G AGGTC
A C
C - G
G - C
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |