Sequence ID | >SRA1014446 |
Genome ID | SRR023845.145531 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 165 |
End posion on genome | 91 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atcatcagcT |
tRNA gene sequence |
GGCCGCGTGGCCCAACGGATAAGGCGTCTGACTTCGGATCAGAAGATTGCAGGTTCGAAT |
Downstream region at tRNA end position |
tttgcttcca |
Secondary structure (Cloverleaf model) | >SRA1014446 Arg TCG T GAtt tttgcttcca G - C G + T C - G C - G G + T C - G G - C T A T C G T C C A C A A G | | | | | G G C C C G G C A G G C G | | | T T A A G G C T A G AGATT T - A C - G T - A G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |