Sequence ID | >SRA1014447 |
Genome ID | SRR023845.146041 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 51 |
End posion on genome | 140 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gacccgcgac |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTATACCGGAGACGGTA |
Downstream region at tRNA end position |
tcgcagcgtc |
Secondary structure (Cloverleaf model) | >SRA1014447 Ser GCT c GCCA tcgcagcgtc G - C G - C A - T G - C A - T G - C G - C T A T T A C C C A T G A G + | | | | G G G C C G G T G G G C G | | | T T T A G G C C G A G TATACCGGAGACGGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |