Sequence ID | >SRA1014457 |
Genome ID | SRR023845.149036 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 199 |
End posion on genome | 272 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
atcgtagcaa |
tRNA gene sequence |
GTTCGGATGGTGTAGTTGGTTATCACGCGCGCCTCACACGCGCGAGGTCCCGAGTTCGAT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1014457 Val CAC a Aagn nnnnnnnnnn G - C T - A T - A C - G G - C G + T A - T C T T G G C T C A T G A G | | | | | G T T G T G C C G A G C G | | | T T G T C A C T T A G AGGTC C - G G - C C - G G - C C - G C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |