Sequence ID | >SRA1014475 |
Genome ID | SRR023845.156204 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 95 |
End posion on genome | 23 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ccttattacg |
tRNA gene sequence |
GTCTAATTAGTTCAGTGGTAGAACACTCGCTTGTGGTGCGGGTTACACGAGTTCGATTCT |
Downstream region at tRNA end position |
ctgaaagcta |
Secondary structure (Cloverleaf model) | >SRA1014475 His GTG g CCAt ctgaaagcta G - C T + G C - G T + G A - T A - T T - A T T T T G C T C A G A A | | | | | G T C T T G A C G A G C G | | | | T T G G A A C T A A TTAC C - G T + G C - G G - C C - G T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |