Sequence ID | >SRA1014478 |
Genome ID | SRR023845.157063 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 135 |
End posion on genome | 211 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccaacacccg |
tRNA gene sequence |
AGCGGGGTGGCGCAGTTCGGTAGCGCAGGTGGCTCATAACCATCAGGTCGTCGGTTCAAA |
Downstream region at tRNA end position |
ccccaccacg |
Secondary structure (Cloverleaf model) | >SRA1014478 Met CAT g ACCA ccccaccacg A C G - C C - G G - C G - C G - C G - C T A T C A G C C A T G A G | | | | | A T C G C G G T C G G C C | | | | T T G G C G C G T A A AGGTC G - C G + T T - A G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |