Sequence ID | >SRA1014485 |
Genome ID | SRR023845.160085 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 133 |
End posion on genome | 61 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
actcagcttg |
tRNA gene sequence |
ACCTACTTGACTCAGCGGTTAGAGTATCGCTTTCATACGGCGAGAGTCATTGGTTCAAAT |
Downstream region at tRNA end position |
ccgaaagccc |
Secondary structure (Cloverleaf model) | >SRA1014485 Met CAT g Aagg ccgaaagccc A - T C - G C - G T - A A - T C - G T - A T A T T A A C C A C G A G | | | | | A G C T C A A T T G G C G | | | | T T T G A G T T A A GAGTC T - A C - G G - C C - G T + G T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |