Sequence ID | >SRA1014491 |
Genome ID | SRR023845.163102 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 127 |
End posion on genome | 57 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
acgtatgcgg |
tRNA gene sequence |
GCGCCGTTGGTTTAGTGGTAAAATATCTCGTTGCCAACGAGATGCCCCGGGTTCGATTCC |
Downstream region at tRNA end position |
tcttatgctg |
Secondary structure (Cloverleaf model) | >SRA1014491 Gly GCC g Attc tcttatgctg G - C C - G G - C C - G C - G G - C T - A T T T G G C C C A G A G | | | | | G T T T T G C C G G G C G | | | + T T G A A A T T A A TGCC T - A C - G T - A C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |