Sequence ID | >SRA1014514 |
Genome ID | SRR023845.174775 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 152 |
End posion on genome | 239 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttttataatt |
tRNA gene sequence |
AGAGAAGTGGCAGAGTGGTCGATTGCGGCGGTCTTGAAAACCGCTGACTGTAACAGGTCC |
Downstream region at tRNA end position |
aaaggtccgt |
Secondary structure (Cloverleaf model) | >SRA1014514 Ser TGA t GCAA aaaggtccgt A - T G - C A - T G - C A - T A - T G - C T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G + | | | T T T T T G C C G A G TGACTGTAACAGGTCC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |