Sequence ID | >SRA1014516 |
Genome ID | SRR023845.175045 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 122 |
End posion on genome | 49 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggcgagcctc |
tRNA gene sequence |
GCCGGCCTGGCGCAATTGGTAGCGCATCCGACTTGTAATCGGAAGGTTACGGGTTCAAGT |
Downstream region at tRNA end position |
ttctcccgcc |
Secondary structure (Cloverleaf model) | >SRA1014516 Thr TGT c TCtc ttctcccgcc G - C C - G C - G G - C G - C C - G C - G T G T T G C C C A T A A G | | | | | A T C G C G A C G G G C G | | | | T T G G C G C T A A AGGTT T - A C - G C - G G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |