Sequence ID | >SRA1014531 |
Genome ID | SRR023845.186472 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 49 |
End posion on genome | 145 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
cgcggctcaa |
tRNA gene sequence |
CGGAAGGAAATCGTCCCTGGTGGGGCGGCTGGGCTTCAAACCCAGTTGGTGGCGCCATGC |
Downstream region at tRNA end position |
cctttctgtt |
Secondary structure (Cloverleaf model) | >SRA1014531 SeC TCA a CCAt cctttctgtt C - G G - C G - C A - T A - T G - C G - C A - T C T A A C G C C C C C C A | | | A T T G C T T G G G T G G + + T C G G G C G T G G G TTGGTGGCGCCATGCGTCGCCGGG C - G T - A G - C G - C G - C C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |