Sequence ID | >SRA1014536 |
Genome ID | SRR023845.188638 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 152 |
End posion on genome | 80 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gtcaccgaca |
tRNA gene sequence |
GCCCCTGTGGCCTAATGGATAAGGCATCGGTCTCCTAAACCGGGGATTGAGGGTTCGAGT |
Downstream region at tRNA end position |
cctggccatc |
Secondary structure (Cloverleaf model) | >SRA1014536 Arg CCT a Agta cctggccatc G + T C - G C - G C - G C - G T - A G - C T G T C T C C C A T A A G | | | | | G G T C C G G A G G G C G | | | | T T A A G G C T A A GGATT T + G C - G G - C G - C T - A C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |