Sequence ID | >SRA1014538 |
Genome ID | SRR023845.189371 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 190 |
End posion on genome | 107 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gggtgtgcat |
tRNA gene sequence |
GGCAAGTTACCCCAAGCGGCCAAAGGGATCTGACTGTAAATCAGACTGCTCAGCATTCGG |
Downstream region at tRNA end position |
gcgaaacacc |
Secondary structure (Cloverleaf model) | >SRA1014538 Tyr GTA t ACac gcgaaacacc G - C G - C C - G A - T A - T G - C T - A T A T C T C C C A C G A A A | + | | | G G C C C C G G G G G C G | | | T T C A G G G C A A A CTGCTCAGCATTC T - A C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |