Sequence ID | >SRA1014539 |
Genome ID | SRR023845.189488 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 2 |
End posion on genome | 73 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
GGTAACGTGACCGAGCGGCTAGGTAGAGGTCTGCAAAACCTCCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
tttaattcgc |
Secondary structure (Cloverleaf model) | >SRA1014539 Cys GCA t TCtt tttaattcgc G - C G - C T - A A - T A - T C - G G - C T A T T C G C C A G A G | | | | | G C G C C A A G C G G C G | | | T T G A G G T C T A CTAC G - C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |